Chst10 antibody thermo
WebHNK-1ST/CHST10 antibodies are validated with different applications, which are IHC-P. HNK-1ST/CHST10 cDNA Clone (13) HNK-1ST/CHST10 cDNA clones are full length sequence confirmed and expression validated. There are 13 kinds of tags for each HNK-1ST/CHST10 of different species, especially GFP tag, OFP tag, FLAG tag and so on. … WebImmunohistochemical analysis of paraffin-embedded human gliomas using 12013-1-AP (CHST10 antibody) at dilution of 1:50 (under 10x lens). View All Images (2) Save time and replace your secondary antibodies with our FlexAble Antibody Labeling Kits $389 / 150 μL Cat No. 12013-1-AP In stock.
Chst10 antibody thermo
Did you know?
WebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, … WebThermo Fisher Scientific's CHST10 Antibody is a Rabbit Polyclonal antibody. This antibody has been shown to work in applications such as: Immunohistochemistry, …
WebIHC-P analysis of human lung carcinoma tissue using GTX87551 CHST10 antibody. The picture on the right is blocked with the synthesized peptide. GTX87551 WB Image WB analysis of HUVEC cell lysates using … WebThere are currently no images for Carbohydrate Sulfotransferase 10/CHST10 Antibody (NBP2-97238R). Every product we sell is backed by Novus' 100% Guarantee . If you …
WebCHST10 (HNK-1ST) protein expression summary. We use cookies to enhance the usability of our website. If you continue, we'll assume that you are happy to receive all cookies. ... Antibody specificity analysis with protein arrays. Predicted and matching interactions are shown in green. Antibody dilution: 1:3000: 1:500: ANTIGEN INFORMATION; WebAnti-CHST10 Antibody Products from Thermo Fisher Scientific. Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate sulfotransferase 10' in humans and may also be known as HNK1ST, HNK-1ST, HNK-1 sulfotransferase, and huHNK-1ST. Structurally, the protein is reported to be 42.2 …
WebType Antibody Immunogen A synthetic peptide derived from the internal region of human CHST10 Conjugate Unconjugated Form Liquid Concentration 1mg/ml Purification …
WebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG Class Polyclonal Type Antibody Conjugate … dick sporting goods tempeWebATP7B Antibodies. Antibodies that detect ATP7B can be used in several scientific applications, including Western Blot, Immunocytochemistry, Immunohistochemistry, Immunoprecipitation and ELISA. These antibodies target ATP7B in Human, Rat and Mouse samples. Our ATP7B polyclonal and monoclonal antibodies are developed in Rabbit … dick sporting goods temeculaWebA superior strategy for validation of antibody: Blocking peptide validation; Independent Antibody Verification; phospho-antibody made by Affinity; Fruit fly studies guide investigators to misregulated mechanism in human cancers; G Protein-Coupled Receptors (GPCRs) win 2012 Nobel Prize in Chemistry city apartment aestheticWebRabbit polyclonal antibody raised against synthetic peptide of CHST10.IgGy Antibody Selector – Quickly search hundreds of thousands of antibodies available for … city apartment aditya world city addressWebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG ... Conjugate Unconjugated Immunogen A synthesized peptide derived from human CHST10, corresponding to a region within the internal amino acids. Form Liquid Concentration 1mg/mL Purification Affinity … dick sporting goods tickerWebFawn Creek Township is a locality in Kansas. Fawn Creek Township is situated nearby to the village Dearing and the hamlet Jefferson. Map. Directions. Satellite. Photo Map. dick sporting good stock priceWebRabbit Polyclonal CHST10 antibody Internal Region for ELISA, ICC, IF, IHC, WB. Order anti-CHST10 antibody ABIN6258961. language English local_shipping United States phone+1 877 302 8632; Contact; person Login favorite_border Comparison List shopping_cart Basket menu; north; arrow_back. search. search. Phone: +1 877 302 … cityapartment an der petrikirche